DNA

Introduction

Central Dogma

 The statement below is often referred to as the central dogma of biology.

DNA is an ideal genetic material because it can store information, is able to replicate, and is able to undergo changes (mutate).

This exercise will explore the structure of DNA and DNA replication. These are indicated in red on the diagram above. The remainder of the above diagram (transcription and translation) will be studied in the next exercise.

Structure of DNA

DNA is composed of units called nucleotides. Each nucleotide contains a phosphate group, a deoxyribose sugar, and a nitrogenous base.

The nucleotides joined together to form a chain. The phosphate end of the chain is referred to as the 5¹ end. The opposite end is the 3' end.

DNA is composed of two chains of nucleotides linked together in a ladder-like arrangement with the sides composed of alternating deoxyribose sugar and phosphate groups and the rungs being the nitrogenous bases as indicated by the diagram below.

The "A" of one strand is always paired with a "T" on the other. Similarly, the "G" of one strand is paired with a "C" on the other.

The two strands are held together by hydrogen bonds (electrostatic attraction). Two hydrogen bonds hold adenine to thymine. Three bonds attach cytosine to guanine as indicated in the diagram above.

Laboratory Exercise

Structure of DNA

Plastic beads will be used to represent the components of DNA indicated in the table below.

NOTE: Please be careful when snapping the beads together; they break easily and are very expensive.

Model  Component	Chemical Represented	# Needed
White	Deoxyribose	120
Red	Phosphate group	120
Orange	Adenine (A)	30
Yellow	Thymine (T)	30
Green	Guanine (G)	30
Blue	Cytosine (C)	30
Clear	Hydrogen bond	30

Assemble 30 nucleotides using one red, one white, and one yellow bead each as shown below. Do not join them together to form a chain yet. Each nucleotide should consist of only three beads.

Assemble 30 nucleotides using red, white, and green beads. Do not join them together; each nucleotide should consist of three beads only.

Assemble 30 nucleotides using red, white, and blue beads. Do not join them together; each nucleotide should consist of three beads only.

Assemble 30 nucleotides using red, white, and orange beads. Do not join them together; each nucleotide should consist of three beads only.

Place all of the nucleotides containing "A" in one group. Place all of the nucleotides containing "T" in a second group, all of the "G" in a third and all of the "C" in a fourth. There should be 30 nucleotides in each group.

Assemble 30 of the nucleotides into one polynucleotide chain in the order listed below. BE SURE that the nucleotides are oriented correctly. There should be a red bead on the left of the chain. The other end of the chain should be the 3' position of the deoxyribose (white) bead.

5' end   ATAGCATGCAGACCATGACTTCGTAGTGCG   3' end

Construct a second polynucleotide chain that is complimentary to the first. Be sure that the 5' end of this second strand faces the opposite direction of the 5' end of the first strand.

Join the two strands using the clear connectors which represent hydrogen bonds.

The finished molecule should look like the photograph below.

The ladder-like model that you just completed should be twisted to show the final form of DNA. This model of DNA will be used in the exercise on DNA replication below..

Concepts

If a species has 23% "A" in its DNA, what percentage of "C" does it have?

In the drawing of DNA below, what end of the strand is indicated by A? _____   B? _____   C? _____

DNA Replication (DNA Synthesis)

The goal of this exercise is to learn how a molecule of DNA is copied to produce two identical molecules.

Before you begin, be sure that you can answer the following questions: 

What is the difference between chromosome doubling and DNA synthesis? [answer]

When does chromosome doubling occur? [answer]

When does DNA synthesis occur? [answer]

Unwind the DNA model and place it horizontally on the desk so that the strand listed below is on the bottom.

5' end   ATAGCATGCAGACCATGACTTCGTAGTGCG   3' end

The 3' end of this strand should be on the right and the 5' end on the left. The 5' end of the upper strand should be on the right and the 3' end of the upper strand should be on the left. See the photograph below.

Beginning on the right, separate the first eight base pairs by removing the hydrogen bonds. These strands are now ready to be copied. Each of these strands will serve as a template for the synthesis of a new strand.

Replication can only proceed in one direction. It begins at the 3' end of the strand to be copied. The new strand is therefore assembled in the 5' to 3' direction.

Bring a nucleotide containing "C" to the "G" on the 3' end of the bottom strand. Orient this nucleotide so that the 5' direction (the phosphate group) is toward the right.

Use a connector representing a hydrogen bond to connect the "C" to the "G". This is the beginning of a new strand.

Continue adding nucleotides to this strand until you have added eight of them. This new strand is called the leading strand.

The top strand cannot be created from the 5' end because synthesis moves toward the 5' end of the template strand. Instead, add a complimentary nucleotide to the 4th nucleotide from the right end. The fourth one from the end is an "A", so you will add a "T". Connect this to the template strand using the clear plastic connectors that represent hydrogen bonds.

Be sure that this nucleotide is oriented so that the 3' end is toward the right and the phosphate group is toward the left. The orientation of the new strand must be opposite that of the template strand.

Add the remaining four complimentary nucleotides moving to the right as you add each one.

When you reach the right end of this strand, go back eight nucleotides to the left and add the complimentary nucleotide.

Next, add the nucleotide that goes to the right of this one. Add the next two. Do not connect the last one (the 5th one from the right), to the 4th one from the right. This strand is synthesized in fragments. The connections will be made later. This strand is called the lagging strand.

Below: Notice that the lagging strand is composed of two fragments.

Separate the remaining nucleotides of the template strands.

Continue adding the complimentary nucleotides to the leading strand.

Move to the 11th nucleotide from the right (5') end on the lagging strand. Add the complimentary nucleotide to the template nucleotide. Add the next two nucleotides but do not bond this fragment to the four nucleotide fragment to the right. At this point, the lagging strand contains three fragments.

Move to the first nucleotide at the 3' end (left end) of the template strand and add the correct complimentary nucleotide.

Complete this final fragment by adding the next two nucleotides to the right.

When you are finished with the model, disassemble it into nucleotides and return them to the plastic storage bag.

Concepts

Write the central dogma of biology and tell what part is represented by the exercise above. The concept of central dogma is discussed in the first paragraph of this laboratory exercise.

 

 Name the molecule in the photograph below.

What process is illustrated below.

Point (or circle) on the diagram all places where the next nucleotide can be added to a growing strand of DNA.